The ageing Process

[BertiWooster]

Quite frequently i'm told that I look much younger than my age ( people are suprised when I tell them my age )

It's the same with my mother- she is in her late seventies, and has hardly any wrinkles on her face .

Yet , some folk look far older than they actually are .

This has got me thinking as to the reason for the way we age .
Is there a scientific explanation ?

[rov1200]

You can tell a lot about the mental age by reading some of the postings on this site.

[wildwood]

Looking older is entirely different than being old, although the two often happen in unison. The wrinkly look is programmed in our genes and can be vastly accelerated with an unhealthy lifestyle. It is true that we are only as old as we feel.

It is not the years that count in your life, it's the life in your years.

Uncle Abe.

[rov1200]

Biological aging is all down to your telomeres. These are found at the end of your chromosomes. On cell division a portion is lost and like a cat with 9 lives the cell can only reproduce so many times. It is natures way of ensuring we only live for a set period of time.

On the DNA level, the telomere is a dull stretch of road. It is a length of DNA monotonously made up of a recurring motif of 6 nucleotide bases (namely, the sequence TTAGGG) together with various associated proteins. The TTAGGG motif is tandemly repeated. It reads TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG and so on

[rov1200]

On average after a cell has divided between 60 and 100 times and the telomeres have been used up the cell dies. Injury to the cell causes regeneration to occur.

[Sqad]

Just take a look at Floyd before his death.

Ageing usually applies to skin condition and this is adversely affected by smoking and drinking.

I assume that you are talking about premature ageing.